Journal: International Journal of Medical Sciences

Article Title: 17β-Estradiol Inhibits Mesenchymal Stem Cells-Induced Human AGS Gastric Cancer Cell Mobility via Suppression of CCL5- Src/Cas/Paxillin Signaling Pathway

doi: 10.7150/ijms.6851

Figure Lengend Snippet: CCL-5 induces AGS cell mobility via Src signaling pathway. (A) AGS cells were pretreated with vehicle, LY294002 (Akt activation inhibitor, 1μM), U0126 (ERK1/2 activation inhibitor, 1μM), SB203580 (p38 MAPK inhibitor, 1μM), SP600125 (JNK1/2 inhibitor, 1μM) or PP2 (Src inhibitor, 1μM) for 1h, and followed by recombinant CCL-5 (10 ng/ml) administration for 24h. (B) AGS cells were treated with these inhibitors, respectively. AGS cells were harvested and measured for cellular mobility capacity. **, p <0.01 versus control (line 1); ##, p <0.01 versus CCL-5 treatment (line 2) (mean ± SD, n = 3).

Article Snippet: The LY294002 (PI3K inhibitor), U0126 (MEK1/2 inhibitor), SB203680 (p38 MAPK inhibitor), SP600125 (JNK inhibitor), and PP2 (Src inhibitor) were purchased from TOCRIS (Ellisville, Missouri, USA).

Techniques: Activation Assay, Recombinant, Control

Journal: Current biology : CB

Article Title: Estrus-Cycle Regulation of Cortical Inhibition.

doi: 10.1016/j.cub.2019.01.045

Figure Lengend Snippet: Figure 5. Action of 17 Beta-Estradiol Occurs Locally in the Cortex through Estrogen Receptor b in PV+ Neurons (A) In vivo local application of 17 beta-estradiol to the surface of the cortex with juxtacellular recording in ovariectomized female rats. (B) Example traces of fast-spiking neuron after vehicle application (above) and 17 beta-estradiol application (below) after 2 h of diffusion. (C) Ongoing firing rates of all recorded cells after vehicle or 17 beta-estradiol application to cortex (Mann-Whitney U test, p = 0.013; N = 9 Veh, N = 14 E2; experiment and analysis performed blind to condition). (D) VGAT-Venus transgenic rats were ovariectomized 2 weeks prior to brain slice recording. Coronal brain slices were prepared 2–3.5 mm posterior from Bregma. Layer V cells were selected with fluorescent illumination and characteristic fast-spiking neuron firing patterns (example trace). (E) Example of recorded cell which underwent post hoc processing to confirm that it was PV+. VGAT-Venus signal (left), PV/Alexa 633 nm signal (middle), Streptdavidin 350 nm signal (right) are shown. (F) Example of cell after baseline characterization (left) and after 250 nM 17 beta-estradiol wash-in (right). (G) Change in rheobase after estradiol wash-in for all recorded fast-spiking cells (Wilcoxon signed rank test, p = 0.002; N = 10). (H) Change in rheobase after estradiol in the presence of estrogen receptor b blocker PHTPP (passed Shapiro-Wilk normality test; paired t test, p = 0.521; N = 5). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Horizontal bars represent means. See also Table S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti-Parvalbumin Swant Cat#PVG-213; RRID:AB_2650496 Mouse anti-parvalbumin Swant Cat#V235; RRID:AB_10000343 Donkey anti-Goat, Alexa Fluor 546 ThermoFisher Cat#A-11056; RRID:AB_142628 Donkey anti-Goat, Alexa Fluor 633 ThermoFisher Cat#A-21082; RRID:AB_141493 Anti-Digoxigenin-AP Fab fragments Roche cat# 11093274910; RRID: AB_514497 Anti-Digoxigenin-POD Fab fragments Roche cat# 11207733910; RRID: AB_514500 Alexa Fluor 594 Donkey Anti-Mouse Jackson ImmunoResearch Laboratories 715-585-150; RRID:AB_2340854 Chemicals, Peptides, and Recombinant Proteins 17 beta-estradiol Sigma Cat#E8875 PHTPP Tocris Cat#2662 Neurobiotin Vector Cat#SP-1120; RRID:AB_2313575 Alexa Fluor 488 Streptavidin Invitrogen Cat#S11223; RRID:AB_2336881 Alexa Fluor 546 Streptavidin Invitrogen Cat#S11225; RRID:AB_2532130 Alexa Fluor 350 Streptavidin Invitrogen Cat#S11249 Roti-Mount FluoCare DAPI Carl Roth Cat#HP20.1 DMSO Sigma Cat#D2650 Sesame Oil Sigma Aldrich Cat#S3547 QX-314 Tocris Cat#2313 Blocking reagent Roche Cat# 11096176001 NBT Roche Cat# 11383213001 BCIP Roche Cat# 11383221001 DIG-labeling nucleotide mix Roche Cat# 11277073910 Cy2 Streptavidin Jackson ImmunoResearch Laboratories Cat# 016-220-084; RRID:AB_2337246 Biotin-tyramide ApexBIO Cat# A8011 Fluoroshield with DAPI Sigma Cat# F6057 pEASY-Blunt Zero Cloning Kit Transgen Biotech Cat# CB501 2 3 Phusion master mix NEB Cat# M0531 Critical Commercial Assays Vectastain ABC Kit Vector Laboratories Cat#PK-4000 Experimental Models: Organisms/Strains Rat: Wistar Janvier Labs N/A Rat: Wistar Harlan Laboratories N/A Rat: Sprague Dawley Beijing Vital River Laboratory Animal Technology Co., Ltd. N/A Rat: VGAT-Venus transgenic [28, 29] N/A Oligonucleotides primer rEsr2-v1 forward: AGTAGGAATGGTCAAGTGTGGATCCAGG This paper N/A primer rEsr2-v1 reverse: GAGAAAGAAGCATCAGGAGGTTGGCC This paper N/A primer rEsr2-v2 forward: ATGAAGTGTGGTCCCTGGACGC This paper N/A primer rEsr2-v2 reverse: AGGAGACAGGTGCCCAGAAGTTGG This paper N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Spike2 CED N/A (Continued on next page) e1 Current Biology 29, 1–11.e1–e6, February 18, 2019

Techniques: In Vivo, Diffusion-based Assay, MANN-WHITNEY, Transgenic Assay, Slice Preparation

Journal: eLife

Article Title: Overexpression screen of interferon-stimulated genes identifies RARRES3 as a restrictor of Toxoplasma gondii infection

doi: 10.7554/eLife.73137

Figure Lengend Snippet:

Article Snippet: Peptide, recombinant protein , PrimeSTAR GXL DNA Polymerase , Tocris Biotechnology , Cat#: R050 , Genomic DNA amplification.

Techniques: Expressing, Luciferase, Staining, Transfection, Recombinant, Plasmid Preparation, Virus, CyQUANT Assay, LDH Cytotoxicity Assay, Cell Culture, Lysis, Amplification, DNA Amplification, Software